DNA-AgNCs – University of Copenhagen

DNA-AgNCs

On this page you can find photophysical information on HPLC purified DNA-stabilized silver nanoclusters that have been produced and characterized in the nanospectroscopy group.

---

5'- CACCGCTTTTGCCTTTTGGGGACGGATA -3'

https://pubs.acs.org/doi/pdf/10.1021/acsomega.7b00582

---

5'- TTCCCACCCACCCCGGCCC -3'

http://pubs.rsc.org/en/content/articlepdf/2017/cc/c7cc06785b

---

5’- CACCTAGCGA -3’ Has a very large Stokes shift!

https://iopscience.iop.org/article/10.1088/2050-6120/aaa8bc

---