DNA-AgNCs

On this page you can find photophysical information on HPLC purified DNA-stabilized silver nanoclusters that have been produced and characterized in the nanospectroscopy group.

---

5'- CACCGCTTTTGCCTTTTGGGGACGGATA -3'

https://pubs.acs.org/doi/pdf/10.1021/acsomega.7b00582

---

5'- TTCCCACCCACCCCGGCCC -3'

http://pubs.rsc.org/en/content/articlepdf/2017/cc/c7cc06785b

---

5′-TTCCCACCCACCCCGGCCCGTT-3′  

https://pubs.acs.org/doi/pdf/10.1021/acsomega.9b00614

---

5’- CACCTAGCGA -3’ Has a very large Stokes shift!

https://iopscience.iop.org/article/10.1088/2050-6120/aaa8bc

Crystal Structure!

http://release.rcsb.org/structure/6JR4

https://onlinelibrary.wiley.com/doi/10.1002/anie.201906766

5’- CACCTAGCGA -3’ (-A10 mutant)

Crystal Structure!

https://www.rcsb.org/structure/6m2p

https://pubs.rsc.org/en/content/articlepdf/2020/ra/d0ra02672g

---

5'-CCCGGAGAAG-3' NIR emitter with high fluorescence quantum yield

https://pubs.rsc.org/en/Content/ArticleLanding/2020/CC/D0CC01849J#!divAbstract